Recent technological advances in cell line and bioprocess development have driven significant improvements in product titers and enabled scientists to accelerate product development timelines (1). Despite those successes, many limitations in developing cell lines for biotherapeutics remain. One example in fed-batch cultures is an apparent paradox: when cell growth is inhibited by high osmolarity after multiple additions of concentrated nutrients intended to enhance cell growth and protein production. Generation of novel host cells to overcome specific bottlenecks found in bioprocessing is highly desirable.

Imposing hyperosmotic stress conditions on commercially popular production lines such as Chinese hamster ovary (CHO) and NS0 has previously been shown to improve specific productivity (2,3). That appears to correlate with cellular changes in transcription, translation, protein secretion, and metabolism (4,5). Shen and Sharfstein analyzed transcriptional response to osmotic shock using DNA microarray and RT-PCR techniques (6), and Yee et al. applied DNA microarray and two-dimensional gel electrophoresis to analyze proteomic profiles in response to sodium butyrate treatment (7). Although several investigators have reported that specific productivity can be enhanced by higher osmolarity, the overall protein yield was not substantially improved because of poor cell viability and growth when osmolarity exceeded 420–450 mOsm/kg. Kim and Wu, et al. speculated the cause to be cell growth inhibition and apoptosis induction from osmolarity pressure (8,9). Although these studies have contributed to elucidating the effect of a high-osmolarity environment on cell behavior and cellular processes, few investigators have explored whether altering a host cell can help it overcome a high-osmolarity environment.

PRODUCT FOCUS: All Biologics
PROCESS FOCUS: Production
WHO SHOULD READ: Product and process development
KEYWORDS: CHO DG44, fed-batch culture, osmolarity resistance, nutrient feeding strategy, cell line engineering
LEVEL: INTRODUCTION

Adapting host cells to overcome other environmental or bioprocessing obstacles has been explored for limited and specific applications. For example, adapting them to defined media formulations is widely reported, with recent emphasis on novel media components and animal-origin free raw materials (10,11). Berdichevsky et al. successfully isolated a faster-growing cell population after extensive passaging and adaptation to improve virus production (12). Timelines for such spontaneous adaptation events tend to be lengthy, however, and efforts may be unsuccessful especially for isolating rare biological traits.

Genetic engineering is a more direct approach for host-cell improvement. Successful examples include cell growth enhancement through introduction of cell cycle control, growth factor, and anti-apoptosis genes (13). Other host improvements have improved protein quality by overexpressing glycosyltransferase/glycosidase genes (14) or knocking out the fucosyl transferase gene (15). These approaches often require extensive knowledge of the genes and cellular mechanisms involved.

To overcome the various technical constraints, we investigated whether novel host cells could be generated by a new methodology that first produces a genetically diverse cell population from which cells exhibiting a rare or difficult-to-find phenotype then can be screened and isolated. Generation of the genetically diverse population is achieved by temporarily suspending the DNA mismatch repair (MMR) mechanism of dividing cells (16). Screening and isolation are achieved by applying environmental selective pressure.

The approach of disrupting MMR is based on introducing the truncated hPMS2-134 gene: the Revolution gene (Figure 1), which is an allelic variant of the human PMS2 gene product (17,18). CHO cells harboring this genetic variant have been shown to accumulate mutations at significantly higher frequencies (100–500 fold enhancement) than controls (16). The nontoxic nature of this approach also resulted in robust cells that could progress through cell cycle checkpoints with virtually no loss in viability (16,19). The outcome is generation of a hardy and broad library of cells from which subclones with desired characteristics can be screened and isolated (20,21). After such isolation, the gene can be removed using a negative selection marker for restoration of the MMR mechanism (16).

To test our approach, we used CHO DG44 as our model cell line to evaluate whether genetic diversity can be introduced through Revolution transfection and whether a novel cell population resistant to high osmolarity could be isolated. We also tested whether this isolated phenotype was robust and stable and whether the host cells could be transfected to express a monoclonal antibody under fed-batch conditions for future bioprocessing applications.

Materials and Methods

Parental DG44 Cells and Culture Conditions: We purchased CHO DG44, a dihydrofolate reductase (dhfr)–deficient cell line derived from CHO cells, from Life Technologies Corporation (www.lifetechnologies.com). Cells were cultured in growth medium, a chemically defined, serum-free formulation consisting of CD DG44 medium supplemented with 8 mM glutamine and 0.2% (w/v) pluronic F-68 (all media and reagents also from Life Technologies). Cells were routinely passaged every three to four days and cultured in 125-mL or 1-L shake flasks from Corning Life Sciences (www.corning.com) set on orbital shaker platforms and incubated at 37 °C, 8% CO₂, and 80% relative humidity.

Vector Design for Suspension of DNA Mismatch Repair: We used a vector containing 402 bp of the truncated Revolution hPMS2-134 gene, acquired under an exclusive license from Morphotek Inc. (www.morphotek.com), to transfect CHO DG44 cells. Transfected cells were selected for the plasmid-borne neomycin gene by addition of Gibco BRL Geneticin antibiotic (500 µg/mL). For subsequent selection of cells that eliminated the Revolution gene, we located the herpes simplex virus thymidine kinase (HSV-TK) gene, which confers ganciclovir sensitivity, immediately downstream of and coexpressed with the Revolution gene (Figure 1). We added 40 µM ganciclovir to negatively select cells that no longer harbored the plasmid-derived Revolution-HSV-TK genes. This allowed for isolation of selected cells with a restored DNA mismatch repair mechanism.

Generation of a High-Osmolarity–Tolerant CHO DG44 Host Cell: We transfected parental CHO DG44 cells with the Revolution gene using the FreeStyle MAX system from Life Technologies according to manufacturer recommendations. After 48 hours, transfected cells were selected in growth medium with 500 µg/mL Geneticin antibiotic until viability fully recovered to 95%. We isolated single clones using limited-dilution cloning, then screened them by reverse-transcription polymerase chain reaction (RT-PCR) and Western blot for expression of the Revolution gene. Three clones were pooled, and cells were passaged every two to three days for ~80 generations to allow mutations to accumulate.

We then shifted the evolved cells into hyperosmotic conditions (450, 500, and 550 mOsm/kg) by adjusting the growth medium with a 5 M NaCl solution from Sigma (www.sigmaaldrich.com). Under these stress conditions, cells were passaged every two to three days and monitored until culture viability fully recovered to 95% or until cultures were unable to recover over repeated passages. We used the pool generated under 500-mOsm/kg conditions (RevO DG44 cells) in subsequent robustness and stability studies. All such studies were conducted with growth medium in flasks cultured on orbital shaker platforms in incubators set at 37 °C, 8% CO₂, and 80% relative humidity.

Generation of IgG Expressing CHO DG44 and RevO DG44 Cells: We used a dhfr-selectable plasmid harboring a proprietary recombinant human IgG sequence, expressed from the human cytomegalovirus (hCMV) promoter, to generate cell lines expressing a monoclonal antibody (Life Technologies). Seed cultures of CHO DG44 and RevO DG44 cells were transfected to express rIgG, again using the FreeStyle MAX system according to manufacturer recommendations. After 48 hours, we initiated selection by passaging transfected cells into production medium (a chemically defined, serum-free, HT-deficient formulation of CD OptiCHO medium supplemented with 8 mM glutamine). During selection, cell pools were passaged twice a week until the cultures fully recovered to >95% viability. The transfected cultures are here referred to as DG44/rIgG and RevO DG44/rIgG. We used addition of 200 nM methotrexate (MTX) from Sigma to the production medium for gene amplification. Cell pools were passaged twice a week until full recovery to >95% viability. Those pools are here referred to as DG44/rIgG/Amp and RevO DG44/rIgG/Amp. We incubated all cultures in shake flasks at 37 °C, 8% CO₂, and 80% relative humidity on an orbital shaker platform.

Protein Expression Studies: For batch culture, we initiated pools of DG44/rIgG and RevO DG44/rIgG cells in triplicate 125-mL shake flasks using seed cultures prepared in production medium. We conducted studies of the amplified pools in production medium supplemented with 200 nM MTX. All flasks were incubated at 37 °C, 8% CO₂, and 80% relative humidity on orbital shaker platforms set at a 130-rpm agitation rate. We drew daily samples for automated cell counts with a Vi-cell counter from Beckman Coulter (www.beckmancoulte.com) and IgG titer analysis.

For fed-batch culture, we initiated pools of DG44/rIgG/Amp and RevO DG44/rIgG/Amp cells in triplicate 1-L shake flasks using seed cultures prepared in production medium with 200 nM MTX. All flasks were incubated at 37 °C, 8% CO₂, and 80% relative humidity on orbital shaker platforms set for a 110-rpm agitation rate. We drew daily samples for automated cell counts, metabolite analysis on a Bioprofile 400 analyzer from Nova Biomedical (www.novabiomedical.com), osmolarity measurement using a Fiske 210 Micro-Sample osmometer from Advanced Instruments, Inc. (www.aicompanies.com), and pH testing with a SevenMulti pH Meter from Mettler Toledo (www.mt.com). Cultures were fed with glucose from Sigma and 200 mM glutamine, to maintain levels at 2–6 g/L and 2–8 mM, respectively. At regular intervals, we also fed concentrated nutrients including commercial feeds and hydrolysates from Life Technologies and added a 5 M NaCl solution to raise culture osmolarity as required. Culture pH was controlled manually in the range of 6.8–7.2 by adjusting with 0.5 M sodium carbonate from Sigma.

Analytical Methods: For a microsatellite PCR assay, we extracted the genomic DNA of parental CHO DG44 and CHO DG44 cells that were transfected and selected for the Revolution gene using the Blood and Cell Culture Midi kit from Qiagen (www.qiagen.com). A BAT25-1 forward primer (GAGGAGTGCCACAAATCAAAGCTAG) from Sigma was fluorescence-labeled and purified by high-performance liquid chromatography (HPLC), as was a reverse primer (CCCAGATTTTCAGATTTTAACCATG) from Integrated DNA Technologies (www.idtdna.com). Each 25 µL of PCR reaction mixture contained 1 µL of primer mixture (10 µM of each forward and reverse primer) and ~1.5 pg (0.5 copy) of the genomic DNA template. The temperature cycling condition we used was one cycle denaturation at 94 °C for five minutes and 45 cycles (94 °C for 30 seconds, 55 °C for 30 seconds, and 72 °C for 30 seconds), followed by a cycle elongation at 72 °C for seven minutes. We analyzed the PCR product using a CEQ 8000 capillary electrophoresis system from Beckman Coulter and calculated the mutation rate based on the PCR product size change relative to a negative control template.

For limited-dilution cloning, we plated

For RT-PCR analysis, we isolated mRNA using an mRNA Catcher PLUS kit from Life Technologies according to the manufacturer’s protocol. We amplified the Revolution gene transcript using a SuperScript III one-step RT-PCR kit, also from Life Technologies.

For the Western blot analysis, we expanded clones positive for Revolution gene expression (determined by RT-PCR analysis) into 125-mL shaker flasks. After a three-day culture, we prepared protein from 1×10⁷ cells by lysing with RIPA buffer from Teknova Inc. (www.teknova.com) containing 1× protease inhibitor from Hoffmann-La Roche Ltd. (www.roche.com). Lysates from 5×10⁵ cells were loaded onto 4–12% Bis-Tris NuPAGE gels and transferred to PVDF membranes (both from Life Technologies). We hybridized the membranes with 7 µg/mL of monoclonal antibody against the PMS2 protein in 1×TBS with 0.05% Tween-20, then incubated them with 1:500 HRP-conjugated goat anti-mouse antibody from Thermo Scientific Pierce (www.piercenet.com). The 17-kD PMS2 protein was detected using the Super Signal West Femto maximum sensitivity substrate from Pierce as per its manufacturer’s instructions.

We quantified the IgG protein titer in triplicate culture samples using an IgG enzyme-linked immunosorbent assay (ELISA). Briefly, 96-well plates were coated overnight with recombinant sheep antihuman IgG primary antibody from Jackson ImmunoResearch (www.jacksonimmuno.com). After blocking with 2% bovine serum albumin (BSA), we added 100 L of standard or samples to each well, and after incubation and washing we added HRP-conjugated antibody. Following incubation and washing, the plate was developed using the TMB substrate from Zymed Laboratories, Inc. (www.zymed.com). Optical density at 450 nm was read by a SPECTRmax Plus microplate reader from MDS Analytical Technologies (www.moleculardevices.com).

Experimental Results

Effect of Osmolarity on Cell Growth: To evaluate the effect of osmolarity on parental CHO DG44 cells, we prepared batches of growth media and adjusted them to different osmolarity levels (300, 450, 500, and 550 mOsm/kg). Cells were passaged initially under isoosmotic conditions for several passages, then shifted at the start of the study into each of the test conditions to characterize cell growth. All cultures were passaged twice weekly in shake flasks under batch mode. We plotted both cumulative population doubling level (PDL) and cell viability over time. As Figure 2 shows, CHO DG44 cells sustained high PDL and viability (>90%) at 300 and 450 mOsm/kg over 30 days. A higher PDL was observed at 300 mOsm/kg, which represents isoosmotic conditions. When they were shifted into hyperosmotic conditions (500 and 550 mOsm/kg), the cells did not appear to grow, and viability dropped steadily to 30–40% without recovering. This confirms previously reported data that CHO DG44 cell growth is inhibited significantly when osmolarity reaches 500 mOsm/kg.

Generation of a Genetically Diverse Cell Population: We transfected the Revolution gene into parental CHO DG44 cells. After selection, pools were cultured for nearly 80 passages under isoosmotic conditions to allow the cells to accumulate mutations. To confirm that the Revolution technology had allowed generation of a genetically diverse population, we isolated clones from the transfected pool and tested for increased presence of mutations using a microsatellite PCR assay. Before evaluating the results, we tested multiple sets of PCR primers to optimize the protocol and selected the BAT25-1 based on reproducibility (showing a single strong PCR-generated band on a 2% agarose gel, data not shown).

As Table 1 summarizes, the parental CHO DG44 cells (negative control) showed only a 1.5% frequency of mutation based on the detection of base-pair insertions and deletions. By contrast, the Revolution-transfected cells showed a 33.3% rate of mutation accumulation ~22-fold greater frequency than the parental cells. These results indicate that the technology did increase the frequency of genomic mutation by inhibiting the cells’ native DNA mismatch repair mechanism. And they confirm that the mutations were heterogeneous as characterized by the different degrees of bp shifts detected. We concluded that the Revolution-transfected CHO DG44 cells were indeed genetically diverse.

Table 1: Microsatellite analysis of parental CHODG44 and Revolution-transfected CHODG44 cells

Resistance to High Osmolarity: Upon confirming that genetic diversity, we shifted the Revolution-transfected CHO DG44 cells into media adjusted to various levels of osmolarity. Those cells grew similarly to their parental CHO DG44 cells in growth medium at isoosmotic conditions (Figure 3). They were also able to grow throughout a 30–day period when shifted into media adjusted to an osmolarity as high as 550 mOsm/kg.

The level of cumulative PDLs was inversely related to osmolarity depending on concentration. At 600 mOsm/kg, the Revolution-transfected cells were unable to survive, indicating toxicity. Furthermore, we found that the transfected cells required no adaptation period typically seen when altering the chemical environment of CHO DG44 cells. A negative control in which CHO DG44 cells were “mock” transfected with a null vector did not survive when shifted to medium adjusted to 500 mOsm/kg. Taken together, these data indicate that the Revolution-transfected CHO DG44 cells exhibited tolerance to high osmolarity, a new phenotypic trait immediately observed after treatment with the Revolution technology.

Robustness and Stability Analysis of RevO DG44: We next evaluated for feasibility as a production host cell line Revolution-transfected CHO DG44 cells isolated after passaging in medium adjusted to 500 mOsm/kg. This cell population (RevO DG44) was evaluated for robustness as well as phenotypic stability.

We tested robustness of the high-osmolarity–tolerant phenotype in RevO DG44 cells by repeated cycling between isoosmotic (300 mOsm/kg) and hyperosmotic (500 mOsm/kg) conditions. The cycling protocol was designed to ensure that cells would grow well at isoosmotic conditions to simulate the start of a fed-batch production run and at hyperosmolarity conditions to simulate the end of the run. Four cycles of medium switches were performed, and the cultures were passaged 10–15 times in batch shake flasks (two passages/week) before shifting.

As Figure 4(TOP) shows, the cultures exhibited steady growth immediately after each shift, and no obvious lags were seen. The average doubling time of RevO DG44 cells in isoosmotic medium was 22±2 hours, which was consistently maintained in all four cycles (Figure 4, BOTTOM). The doubling time of RevO DG44 cells in high-osmolarity medium was ~45 hours during the first two cycles and decreased by 50% to ~32 hours in the third and fourth cycles. This result indicates that a faster-growing cell population was emerging from the RevO DG44 cell pool that retained the high-osmolarity–tolerant phenotype.

To test the stability of that phenotype after the robustness study, we then further passaged the RevO DG44 cells in isoosmotic conditions for 75 generations. During this time, we monitored the cells for their ability to retain tolerance when shifted to hyperosmotic media at early, middle, and late time points. Results show that they maintained tolerance to growth in hyperosmotic conditions (500 mOsm/kg) after 75 generations of passaging at isoosmotic conditions. Doubling times varied ≤15% (Table 2A), and maximum cell densities varied ≤9% (Table 2B) over the course of the study.

Table 2A: Cell doubling time during stability evaluationTable 2B: Maximum cell density during stability evaluation

As Figure 5(LEFT) shows, RT-PCR analysis indicates that the Revolution gene was present both in Revolution-transfected cells cultured at 300 mOsm/kg and in RevO DG44 cells cultured at 500 mOsm/kg. As expected, no PCR product was present in the parental CHO DG44 cells. So the gene was transcriptionally active when cells were cultured at either isoosmotic or hyperosmotic conditions.

We further analyzed the expressed protein of the RT-PCR positive clones using Western blot analysis. Figure 5(RIGHT) shows that clones from both the Revolution-transfected cells cultured at 300 mOsm/kg and RevO DG44 cells cultured at 500 mOsm/kg expressed the 17-kD Revolution protein. It was also expressed in a CHO-K1 positive control; as expected, the parental CHO DG44 cells did not express it. These results confirm that the Revolution protein is expressed when cells are exposed to hyperosmotic culture conditions.

Protein Expression in RevO DG44/rIgG Cells: We assessed recombinant IgG production and cell growth in isoosmotic conditions under batch mode in stably transfected RevO DG44 cells and in those that were additionally MTX-amplified by the dhfr gene. As Figure 6 summarizes, the RevO DG44/IgG pool exhibited a faster doubling time and higher maximum viable cell density (VCD) than the MTX-amplified pool. The final IgG titer was 7.8-fold higher in the amplified pool than in the nonamplified pool. These results demonstrate that RevO DG44 cells can be transfected and selected to express a recombinant protein and that expression can be further amplified using MTX.

Concentrated Nutrient Feeding and High Osmolarity: We used fed-batch shake-flask experiments to evaluate the effect of gradually increasing osmolarity during cell growth and determine whether the RevO DG44 cell line would exhibit altered performance in protein production from that of the parental CHO DG44 cells. Shake flasks seeded with either RevO DG44/rIgG/Amp or DG44/rIgG/Amp cells were fed with concentrated nutrient feeds supplemented by hydrolysates on days 0, 3, 5, 7, 9, and 11. In addition, we maintained the glucose concentration >2 g/L and the glutamine concentration >2 mM throughout the study. The pH was manually maintained at 6.9–7.4 by adjusting with sodium carbonate as needed.

The nutrient feeding scheme led to an increase in culture osmolarity from 290 mOsm/kg to 550 mOsm/kg over 10 days (Figure 7A). On Day 7, we additionally adjusted the cultures by ≤50 mOsm/kg using sodium chloride such that both cultures had matched levels of high osmolarity.

Figures 7B and 7C present the VCD and cell viability profiles for the fed-batch cultures. With concentrated nutrient feeding, the maximum VCD of the RevO DG44/rIgG/Amp culture reached 8.9 × 10⁶ cells/mL, whereas the DG44/rIgG/Amp was able to reach only 4.5 × 10⁶ cells/mL and also exhibited a slower doubling time (Table 3). Both cultures maintained high viability through Day 8 and declined once osmolarity had exceeded 500 mOsm/kg.

Table 3: Summary of cell growth and rIgG expression in fed-batch culture at high osmolarity

Figure 7D depicts the relative concentration profiles of rIgG titer for the RevO DG44/rIgG/Amp and the DG44/rIgG/Amp pools. The rIgG titer increased steadily for both cultures, with the RevO DG44/rIgG/Amp pool exhibiting higher titers toward the end of the study. The final relative concentration of the RevO DG44/rIgG/Amp pool was 1,700 U/L, a ~75% increase in titer over that produced by the DG44/rIgG/Amp cell pool (Table 3). This also represents a ~70% increase over the relative titer obtained in batch culture at 300 mOsm/kg (Figure 6).

We plotted the integral of viable cells against the relative antibody concentration to determine specific productivity (SP, qIgG) for each culture (Table 3). The qIgG of RevO DG44/rIgG/Amp remained relatively constant throughout the culture time (data not shown), whereas the DG44/rIgG/Amp was comparatively higher by ~14%.

Discussion

Here we illustrate the feasibility of a new approach to cell line development and host cell engineering by applying a technology that suspends the cells’ native DNA mismatch repair mechanism. Although the Revolution technology was shown to be effective in suspending MMR in CHO DG44 cells to generate a diverse cell pool, the transfection and selection process remains lengthy. It is possible that simpler and more accessible technologies such as ethyl methanesulfonate (EMS) chemical mutagenesis could be used to generate this diversity. However, previous studies report that sequence analysis of hypoxanthine-guanine phosphoribosyl transferase (HPRT) null clones after EMS treatment resulted in predominantly transition mutants within hotspots (16).

By contrast, sequence analysis of HPRT null clones after MMR disruption showed a random distribution of transitions, transversions, and small insertion/deletion mutants throughout the HPRT gene. Suspension of MMR also provided a higher percentage of surviving colonies, whereas EMS-treated cells had a short, finite growth profile upon clonal expansion (16,22). Therefore, suspension of MMR by transfection of the Revolution gene yielded a more heterogeneous and robust set of mutants than chemical methods did (16).

Interestingly, our results show that Revolution-transfected CHO DG44 cells were able to exhibit tolerance to high-osmolarity stress conditions (500 mOsm/kg and 550 mOsm/kg). No apparent lag in cell growth or loss of viability was observed. And as expected, parental and mock-transfected CHO DG44 cells lost both cell viability and ability to proliferate when tested at 500 mOsm/kg osmolarity. Demonstration of the Revolution gene transcript and protein in cell pools with increased mutation accumulation suggests that the high-osmolarity phenotype is a direct consequence of Revolution gene expression. The new phenotype was observed even though our 22-fold increase in the frequency of mutation accumulation was less than the 100- to 500-fold increase previously reported (16). The increase was probably due to our underestimating mutations because we considered only base-pair deletions and insertions; point mutations and limited spontaneous mutations were not assayed or included in our analysis. So the actual mutation rate of our Revolution-transfected cells was probably >22-fold.

The rapid demonstration of tolerance to high osmolarity levels with no need for adaptation has led us to hypothesize that major intracellular signaling pathways affecting cell survival, proliferation, and/or function may have been genetically altered. Confirming that will require activation and/or knock-down/knock-out studies of candidate genes important in regulation of these pathways. DNA microarray and data-mining strategies may help narrow the list of candidates (23). Although full knowledge of cellular mechanisms was not required to isolate high-osmolarity–tolerant cells, elucidating those biological mechanisms would be useful for future bioprocess applications. In addition, further exploration into the mechanisms and contributions of chaperone proteins in the secretory pathways also would provide interesting applications. The RevO DG44 cell may serve as a useful model system for those types of studies.

RevO DG44 cells were shown to exhibit a robust and stable phenotype for 75 generations. Moreover, after multiple passaging and cycles, a faster-growing subpopulation of cells emerged while the high-osmolarity–tolerant phenotype continued to be maintained. Demonstration of both phenotypic traits shows ability of Revolution-transfected cells to undergo trait-stacking — the selection of more than one phenotypic trait — before curing and restoration of the MMR mechanism. That added phenotype of an improved and reasonable doubling time increases the value of RevO DG44 as a potential host cell line for the development of future biotherapeutics.

Significantly, our fed-batch studies illustrated that RevO DG44 cell growth and protein titers improved with a suitable medium and feeding strategy. Specifically, RevO DG44/rIgG MTX-amplified pools achieved nearly twofold higher cell densities and 1.8-fold higher rIgG titers than DG44/rIgG MTX-amplified pools. We attribute that to their tolerance of high osmolarity when fed concentrated nutrients six times over the course of the culture. Further improvements appear possible, particularly if single clones with higher specific productivities are isolated from the resulting pools. These data agree with other reports that consider the cells’ phenotype, metabolic requirements, and genetic environment to influence protein expression (24). Moreover, final product quality could also be affected if the nature and quality of raw materials in media formulations are considered (10). Ultimately, these measures should serve to optimize cell line survival and production and play an important role in alleviating bottlenecks in bioproduction.

Great Potential

We successfully generated a novel CHO DG44 host cell with the phenotypic trait of tolerance to high osmolarity ≤550 mOsm/kg. This outcome was achieved by temporarily suspending DNA mismatch repair to generate a genetically diverse cell pool, then applying environmental pressure to isolate a cell population exhibiting stable phenotype. Those cells were also able to express a recombinant protein, and such expression was improved with frequent additions of a concentrated nutrient feed. Our data demonstrate the application of this methodology for improving mammalian host cells to overcome limitations in bioprocessing. And they illustrate the advantage for biotherapeutics development of matching phenotype with a suitable media formulation and feeding strategy. Potential applications in research and drug discovery warrant further investigation.

REFERENCES

1.) Wurm, FM. 2004. Production of Recombinant Protein Therapeutics in Cultivated Mammalian Cells. Nat. Biotechnol. 22:1393-1398.

2.) Ozturk, SS, and BO. Palsson. 1991. Effect of Medium Osmolarity on Hybridoma Growth, Metabolism, and Antibody Production. Biotechnol. Bioeng. 37:989-993.

3.) deZengotita, VM, AE Schmelzer, and WM. Miller. 2002. Characterization of Hybridoma Cell Responses to Elevated pCO2 and Osmolarity: Intracellular pH, Cell Size, Apoptosis, and Metabolism. Biotechnol. Bioeng. 77:369-380.

4.) Reddy, S, and WM. Miller. 1994. Effects of Abrupt and Gradual Osmotic Stress on Antibody Production and Content in Hybridoma Cells That Differ in Production Kinetics. Biotechnol. Prog. 10:165-173.

5.) Sun, Z. 2004. Hyperosmotic Stress in Murine Hybridoma Cells: Effects on Antibody Transcription, Translation, Posttranslational Processing and the Cell Cycle. Biotechnol. Prog. 20:576-589.

6.) Shen, D, and ST. Sharfstein. 2005. Genome-Wide Analysis of the Transcriptional Response of Murine Hybridomas to Osmotic Shock. Biotechnol. Bioeng. 93:132-145.

7.) Yee, JC. 2008. Genomic and Proteomic Exploration of CHO and Hybridoma Cells under Sodium Butyrate Treatment. Biotechnol. Bioeng. 99:1186-1204.

8.) Kim, MS. 2002. Biphasic Culture Strategy Based on Hyperosmotic Pressure for Improved Humanized Antibody Production in Chinese Hamster Ovary Cell Culture. In Vitro Cell Dev. Biol.—Animal 38:314-319.

9.) Wu, MH. 2004. The Effect of Hyperosmotic Pressure on Antibody Production and Gene Expression in the GS-NS0 Cell Line. Biotechnol. Appl. Biochem. 40:41-46.

10.) Paul, WC. 2009. Maintaining Product Titer While Replacing Undefined Components in a CHO Culture System. BioProcess Int. 7:30-38.

11.) Zhang, J, and D. Robinson. 2005.Development of Animal-Free, Protein-Free and Chemically Defined Media for NS0 Cell CultureCytotechnol.:59-74.

12.) Berdichevsky, M. 2008. Establishment of Higher Passage PER.C6 Cells for Adenovirus Manufacture. Biotechnol. Prog. 24:158-165.

13.) Arden, N, T Nivtchanyong, and MJ. Betenbaugh. 2004. Cell Engineering Blocks Stress and Improve Biotherapeutic Production. Bioprocessing J. 3:23-28.

14.) Minch, SL, PT Kallio, and JE. Bailey. 1995. Tissue Plasminogen Activator Coexpressed in Chinese Hamster Ovary Cells with Alpha (2,6)-Sialytransferase Contains NeuAc Alpha (2,6) Gal Beta (1,4) Glc-N-AcR Linkages. Biotechnol. Prog. 11:348-351.

15.) Shinkawa, T. 2003. The Absence of Fucose But Not the Presence of Galactose or Bisecting N-Acetylglucosamine of Human IgG1 Complex-Type Oligosaccharides Shows the Critical Human IgG1 Complex-Type Oligosaccharides Shows the Critical Role of Enhancing Antibody-Dependent Cellular Cytotoxicity. J. Biol. Chem. 278:3466-3473.

16.) Nicolaides, NC. 2005. Morphogenics As a Tool for Target Discovery and Drug Development. Ann. NY Acad. of Sci. (Tumor Progression and Therapeutic Resistance supplement) 1059:86-96.

17.) Parsons, R. 1995. Mismatch Repair Deficiency in Phenotypically Normal Human Cells. Science 268:738-740.

18.) Francia, G. 2004. Gene Expression Analysis of Tumor Spheroids Reveals a Role for Suppressed DNA Mismatch Repair in Multicellular Resistance to Alkylating Agents. Mol. Cell. Biol. 24:6837-6849.

19.) Zegerman, P, and JFX. Diffley. 2009. DNA Replication As a Target of the DNA Damage Checkpoint. DNA Repair 8:1077-1088.

20.) Grasso, L. 2004. Enhancing Therapeutic Antibodies and Titer Yields of Mammalian Cell Lines. BioProcess Int. 2:58-65.

21.) Kline, JB. 2006. Improving Protein and Antibody Yields in Scalable Mammalian-Cell–Based Manufacturing. BioProcess Int. 4:42-47.

22.) Wagner, ED. 2003. Evaluation of EMS-Induced DNA Damage in the Single Cell Gel Electrophoresis (Comet) Assay and with Flow Cytometric Analysis of Micronuclei. Teratog. Carcinog. Mutagen. 23:1-11.

23.) Wlaschin, KF, G Seth, and WS. Hu. 2006. Toward Genomic Cell Culture Engineering. Cytotechnol. 50:121-140.

24.) Barnes, LM, and AJ. Dickson. 2006. Mammalian Cell Factories for Efficient and Stable Protein Expression. Curr. Opin. Biotechnol. 17:381-386.

25.) Sellick, CA. 2009. Effective Quenching Processes for Physiologically Valid Metabolite Profiling of Suspension Cultured Mammalian Cells. Anal. Chem. 81:174-183.